Abstract: Although dragonfly larvae can be good bioindictors in fresh water environment assessments, their identification based on morphological characteristics is still a tough work, especially at species level. In the present study, 116 larvae of two Chinese widespread damselfly, Ceriagrion fallax Ris and Ceriagrion auranticum Fraser, were identified depending on sequence data of the mitochondrial genes Cytochrome Oxidase I (COI) and nuclear ribosomal genes ITS. The stability of two important morphological characters, caudal gills and mandibles, was discussed. For molecular analysis, LCO1490d (TTTCTACWAACCAYAAAGATATTGG) and HCO2198d (TAAACTTCWGGRTGTCCAAARAATCA) were used as COI primers, and Vrain2F (CTTTGTACACACCGCCCGTCGCT) and Vrain2R (TTTCACTCGCCGTTACTAAGGGAATC) as ITS primers. The reaction systems were 31.0 μL: DNA template 3.0 μL, upstream and downstream primers 2.0 μL each, Mix 15.0 μL (Jiangsu ComWin Biotech Co., Ltd’s 2×Es Taq Master Mix), ddH₂O 9.0 μL. Take 5.0 μL PCR amplification products and detect them by electrophoresis using 1.5% agarose gel. The amplification products with detected by electrophoresis, and then sent to Chongqing Tsingke Xingye Biotechnology Co to sequence. Neighbor-Joining (NJ) trees and genetic distance method were using for the molecular identification of larvae, with the help of identified adults’ sequences as conference. Relative large size of larval specimens, C. fallax (n=110) and C. auranticum (n=6), were dissected and photographed using LY-WN-OPLENC ultra-clear microphotographic system. Detailed comparative morphological examination was conducted focusing on two typical morphological features, caudal gill and mandibles. Our result showed that: (1) the presence or absence, numbers, and color of the black spots on the caudal gill were unstable, which have nothing to do with populations and sex; (2) characters of mandibles were also variable even within the same population. The discovery of the instability of the two typical diagnostic morphological characters indicates that characters of caudal gills and mandibles, at least, in these two species should be used with caution latterly in taxonomy. Our result also suggests that the similar instability may exist in other diagnostic morphological characteristics in other odonate species. The idea and methodology of this study can be instructive to future morphological studies on insect taxonomy.